Skip to content

Latest commit

 

History

139 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Repository files navigation

nextgen4b

A library to analyze positional error rates in nextgen sequencing data

License

A set of scripts to manipulate and process .fastq files from next-generation sequencing experiments for "rare-base" assays as conducted in the Tyo lab at Northwestern University. In general, these scripts will filter your data for bad sequences, align them to a given template, retrieve the bases at positions of interest, and analyze them in a number of ways.

If you have short, synthetic sequences and are interested in error rates at particular points, this might be the library for you.

Installation

First, clone the repo:

git clone https://github.com/tcyb/nextgen4b

Then install the required packages

pip install -r requirements.txt

You can then install nextgen4b using setup.py:

python setup.py install

If you plan on modifying or contributing code, you can install in-place via symlink:

python setup.py develop

Lastly, you will need to install EMBOSS and a modified biopython

Installing EMBOSS

This code relies on EMBOSS's optimized needle routine in order to perform sequence alignment. You can find instructions on installation here. You will need to add the EMBOSS bin directory to your path for Biopython to be able to access needle.

Adding alignment metadata to Bio.AlignIO

For this code to run correctly, you need a modified AlignIO module that reads the alignment score into the Alignment object's 'annotations' field. This is addressed here: biopython/biopython#692

In order to install and modify biopython, you can do the following:

git clone https://github.com/tcyb/biopython
git reset d980d67d34329312174728427273f8ca063ca4aa

Then follow the instructions to install biopython. Alternatively, you can directly modify the AlignIO code in your existing installation of biopython. Hopefully this will be resolved in a new version of the biopython code.

Usage

Data Assumptions

This code assumes paired-end reads in either FASTQ or gzipped FASTQ format.

Get all your .fastq files into one folder

Typically, we start with sequencing data from the MiSeq at UIC's sequencing core. They give us back *.fastq.gz files in individual folders. Your mileage may vary, but most of the batch-processing routines here assume fastq.gz files all in one common folder. How you get there doesn't make much difference, but for us, it can be a pain in the butt to do manually.

In case your data setup is the same as ours and you're working on Windows, you can get your data into the proper structure using the following command in the command line:

for /r %i in (*.fastq.gz) do @move "%i" .

Generate an experiment-describing YAML file

You will need a *.yaml file that describes the experiments and samples (or runs) in your dataset. This includes information on where to locate the sequence files, what sequence information to expect, and any other experimental notes. The file should look something like this:

ngsruns:
    run1:
        experiments: [exp1]
        f_read_name: TC1_S1_L001_R1_001.fastq.gz
        filter_seqs:
            forward: &id002 [CATTGTCCCTAT, AGACCAAGTCTCTGCTACCGTA]
            reverse: &id003 ['']
        pe_read_name: TC1_S1_L001_R2_001.fastq.gz

    ...

    run20:
        experiments: [exp20]
        f_read_name: TC10_S10_L001_R1_001.fastq.gz
        filter_seqs:
            forward: *id002
            reverse: *id003
        pe_read_name: TC10_S10_L001_R2_001.fastq.gz

experiments:
    exp1:
        barcode: ''
        exp_data: &id001 {}
        name: exp1
        template_seq: GGGCTAGTCGTCTGTATAGGTCTTGCTTCTATCTTTGGCTTCTGTATTTGTCGTCTTGCTTATTGTTCTTGTTCTTATGTTCTGTTCTGGTATTTCGGTT

    ...

    exp20:
        barcode: ''
        exp_data: *id001
        name: exp20
        template_seq: GGGCTAGTCGTCTGTATAGGTCTTGCTTCTATCTTTGGCTTCTGTATTTGTCGTCTTGCTTATTGTTCTTGTTCTTATGTTCTGTTCTGGTATTTCGGTT

Some documentation on nextgen4b YAML files

  • ngsruns - Information about sequence files from either individual sequencing runs or data demultiplexed on the sequencer.
    • runN - Internal label for the run. Can be anything, must be unique within ngsruns
      • experiments - A list of what experiments are contained in the given sequencing run. References the keys in the experiments portion of the YAML file.
      • f_read_name - Where to locate the forward read data for the run. Should point to either a fasta or fasta.gz file.
      • filter_seqs\forward - A list of sequences to look for in forward reads. Absence of these sequences in a given read will cause the read to be filtered. The first sequence in this list will define where the copied DNA starts. The second sequence will define the end of copied DNA.
      • filter_seqs\reverse - A list of sequences to look for in paired end reads. Syntax is identical to filter_seqs\forward
      • pe_read_name - Where to locate the paired-end read data for the run. Should point to either a fasta or fasta.gz file.
  • experiments - Information about experiments represented in sequencing runs. Multiple experiments can exist in one run, and a given experiment can have multiple instances if it occurs in multiple runs (these are not combined).
    • expN - Internal label for the experiment. Can be anything, must be unique within experiments. These should be entries in various ngsruns\runN\experiments lists.
    • barcode - A sequence that would appear 5' of the extension primer for demultiplexing during early iterations of experiments.
    • exp_data - A dictionary to indicate experimental conditions for a given experiment. User-defined and not of consequence here.
    • name - The name of the given experiment. User-defined and can be any string.
    • template_seq - The expected sequence data. This will be what reads are aligned against.

This file should adhere to YAML specs. Tricks and pain points have included:

  • Indentation must use spaces. Hard tabs will cause an error when parsing.
  • Repeated values can be aliased using the &id/*id syntax
  • Fields that should not be used for filtering should be indicated using ''

Performing analysis

Usage has changed a bit, full documentation coming.

Author

  • Ted Cybulski

License

MIT License © 2016 Thaddeus Cybulski

About

A suite of tools to help analyze positional error rates in next-gen sequencing data

Resources

Stars

1 star

Watchers

1 watching

Forks

Releases

Packages

Contributors

Languages