Skip to content

Repository files navigation

install with bioconda GitHub release (latest by date) Conda license

CRISPRme

CRISPRme+ (2.4.0)

📦 Repository, releases & issues → https://github.com/pinellolab/crisprme-plus

CRISPRme is a comprehensive tool designed for thorough off-target assessment in CRISPR-Cas systems. It is available as a command-line interface and an offline tool with a locally deployable web interface. CRISPRme integrates human genetic variant datasets with orthogonal genomic annotations to predict and prioritize potential off-target sites at scale. CRISPRme accounts for single-nucleotide variants (SNVs) and indels, considers bona fide haplotypes, and allows for spacer:protospacer mismatches and bulges, making it well-suited for both population-wide and personal genome analyses. CRISPRme automates the entire workflow, from data download to executing the search, and delivers detailed reports complete with tables and figures through an interactive web-based interface.

✨ What's new in CRISPRme+

  • Dictionary-less variant search — a compact Tier-0 registry + Tier-1 genotype store replace the ~152 GB per-sample SNP dictionaries, so variant-aware search (with allele frequencies + rsIDs) ships with the index and runs out of the box. (methods)
  • Observed-haplotype enumeration — multi-variant off-targets are enumerated only as haplotypes that occur in a real individual (confirmed for phased data, putative for unphased / mixed), removing phantom off-targets and restoring dropped real haplotypes. (methods)
  • COSMIC cancer-gene annotation — off-targets are flagged when they fall in a Cancer Gene Census gene (tier + oncogene/TSG/fusion), alongside updated ENCODE SCREEN v4, GENCODE and DHS annotations. (methods)
  • Shareable off-target assessment report — every run auto-generates a self-contained, branded HTML report (summary, graphical report, recommended validation panel, annotated top-1000, per-tier downloads, annotation legend), downloadable from the results page. (methods)
  • Prebuilt indexes on demand — pull reference data + precomputed indexes from a HuggingFace CDN (crisprme.py download).
  • Build & publish your own dict-less indexesbuild-index-only produces a self-complete variant-aware index in one command (the CRISPRitz index + its _INDELS companion, the Tier-0 allele-frequency registry, the Tier-1 genotype store, the indel logs, the combined samplesID lists, and a build-time variant-count manifest), and publish-index --dictless uploads it (plus the genotype companion) to the HuggingFace CDN — so new precomputed dict-less indexes (new PAMs, genomes, or merged/phased panels) can be built and shared with no code change. Merged multi-dataset panels (bcftools merge) are supported with per-dataset provenance and per-haplotype phasing (phased datasets give confirmed haplotypes, unphased give putative, mixed panels handle each dataset on its own). (protocol)
  • One-command web interface in Docker — no conda, no giant local build (see the Quickstart below).
  • Browser Data-Manager — add genomes, indexes, VCFs, annotations and PAMs from the web UI, with dependency-aware deletion (Dash 2.x).
  • Email notifications — optionally get a results link emailed to you when a job finishes (SMTP configured once under Settings → Email notifications).
  • PAM-geometry-aware search — a pamless (NNN) index serves any PAM of the same length/orientation, so one index covers many PAM variants.
  • Bounded complexity — a --max-total-edits cap and a high-variant-density skip keep dense-variant searches tractable.
  • Diploid assembly-search and merged VCF panels (e.g. 1000G+HGDP) for single-scan population analyses.

⚠️ Note
The original public CRISPRme web service is no longer available.
All functionalities are now accessible via the command-line interface or the locally hosted web interface. See docs/DOCKER_QUICKSTART.md for a quick guide on deploying the web interface locally.

⚡ Quickstart — web interface in Docker (no conda, no giant build)

Easiest: one-line install → a clickable app (no terminal after this)

Not comfortable with the command line? Run one command once, and it installs a clickable CRISPRme app (into Applications / Start Menu) that manages everything — you never touch the terminal again. Requires Docker Desktop.

macOS / Linux (Terminal):

curl -fsSL https://pinellolab.github.io/CRISPRme/install.sh | bash

Windows (PowerShell):

irm https://pinellolab.github.io/CRISPRme/install.ps1 | iex

Then open CRISPRme (Applications on macOS; Desktop / Start Menu on Windows) — a small window with three buttons: Start, Update, Stop. Click Start: the first time it downloads the reference + variant data automatically (~85 GB, once), then opens the web interface at http://localhost:8080; every Start after that is instant. (Genome-wide variant search needs 64 GB RAM; reference-only fits 16 GB.) Details: install/.


Or run the Docker commands yourself

New to CRISPRme? Get the point-and-click web interface running in a few commands — just install Docker, then:

Allocate memory first. In Docker Desktop → Settings → Resources → Memory: 16 GB is enough for reference-only / single-chromosome runs, but the genome-wide 1000G+HGDP variant search shown here peaks around 68–75 GB, so give Docker 64 GB+ for it (32 GB will OOM). (On Linux/Docker Engine the container uses host memory directly.) See System Requirements.

mkdir -p ~/crisprme && cd ~/crisprme
# 1) fast-download the reference data + reference index (minutes, HuggingFace CDN)
#    (this does NOT include the variant index — that is step 2)
docker run --rm -v "${PWD}:/DATA" -w /DATA pinellolab/crisprme:v2.4.0 crisprme.py download --what all --path /DATA
# 2) grab the prebuilt SpCas9 (NRG = NAG+NGG) indexes so no long index build is needed:
#    the reference index, and the compact dict-less variant-aware hg38 + 1000G + HGDP
#    index (the web default; combined allele frequencies + per-individual samples)
docker run --rm -v "${PWD}:/DATA" -w /DATA pinellolab/crisprme:v2.4.0 crisprme.py download --what index --index-name NRG_3_hg38 --path /DATA
docker run --rm -v "${PWD}:/DATA" -w /DATA pinellolab/crisprme:v2.4.0 crisprme.py download --what index --index-name NRG_3_hg38-dictless+hg38_1000G_HGDP --path /DATA
# 3) launch the web interface, then open http://127.0.0.1:8080
docker run --rm -v "${PWD}:/DATA" -w /DATA -p 8080:8080 -it pinellolab/crisprme:v2.4.0 crisprme.py web-interface

Full step-by-step (with variants, more indexes, troubleshooting): docs/DOCKER_QUICKSTART.md.

…or run the same search from the command line

Prefer the CLI? After the download steps above (1 & 2), run the variant-aware example search and generate the shareable report — no web UI needed:

# a genome-wide SpCas9 (NRG) search over hg38 + 1000G + HGDP, up to 6 mismatches
# + 2 DNA / 2 RNA bulges, with combined allele frequencies, rsIDs and annotations
echo "CTAACAGTTGCTTTTATCACNNN" > guide.txt
docker run --rm -v "${PWD}:/DATA" -w /DATA pinellolab/crisprme:v2.4.0 crisprme.py complete-search \
  --genome Genomes/hg38 --pam PAMs/20bp-NRG-SpCas9.txt --guide guide.txt \
  --vcf list_vcf.txt --samplesID list_samplesID.txt \
  --annotation Annotations/dhs+encode_screenv4+gencode+cosmic.hg38.bed.gz \
  --gene_annotation Annotations/gencode.protein_coding.bed.gz \
  --mm 6 --bDNA 2 --bRNA 2 --output my_search --thread 8

# build the self-contained, shareable HTML report (report.html + a data/ folder)
docker run --rm -v "${PWD}:/DATA" -w /DATA pinellolab/crisprme:v2.4.0 crisprme.py generate-report \
  --result-dir Results/my_search
# -> open Results/my_search/<jobid>_report.zip, then report.html

download --what all/index writes list_vcf.txt and list_samplesID.txt for you, so the search above works out of the box on a fresh install.

Table Of Contents

0 System Requirements
1 Installation
  1.1 Install CRISPRme via Conda/Mamba
    1.1.1 Installing Conda or Mamba
    1.1.2 Installing CRISPRme
    1.1.3 Updating CRISPRme
  1.2 Install CRISPRme via Docker
    1.2.1 Installing Docker
    1.2.2 Building and Pulling CRISPRme Docker Image
2 Usage
  2.1 Directory Structure
  2.2 CRISPRme Functions
     2.2.1 Complete Search
     2.2.2 Complete Test
     2.2.3 Off-target sites validation Test
     2.2.4 Targets Integration
     2.2.5 GNOMAD Converter
     2.2.6 Generate Personal Card
     2.2.7 Setup Legacy Database
     2.2.8 Local Web Interface
     2.2.9 Generate Report
     2.2.10 Reference-Index and Data-Distribution Commands
3 Test
  3.1 Quick Test
  3.2 Detailed Test
     3.2.1 Single Chromosome Test
     3.2.2 Full Genome Test
4 Citation
5 Contacts
6 License

0 System Requirements

Memory scales with the search — pick your tier (measured figures):

Search RAM Disk
Reference-only / single-chromosome (toy or reference-genome runs) 8–16 GB ~22 GB (reference-only install)
Whole-genome, variant-aware (e.g. 1000G+HGDP; the web/Quickstart default) 64 GB minimum, ~80 GB for high --max-total-edits ~85 GB (full dict-less install)

The variant-aware genome-wide search is the memory-heavy one: the CRISPRitz search process alone peaks around 68–75 GB loading and traversing the variant index, so 16 GB or 32 GB will OOM a real genome-wide variant search — allocate 64 GB+. Reference-only runs are light (a few GB). To estimate the cost of a large search up front, see docs/SCALABILITY_ANALYSIS.md.

1 Installation

Which version do I get? For CRISPRme+ (2.4.0, this release) use Docker (the Quickstart above, or §1.2). Conda/Bioconda currently installs the stable 2.1.x line (Python 3.8), not the 2.4.0 line — use it only if you specifically want the stable release. If in doubt, use Docker.

This section outlines the steps to install CRISPRme, tailored to suit different operating systems. Select the method that best matches your setup:

Each method ensures a streamlined and efficient installation, enabling you to use CRISPRme with minimal effort. Follow the detailed instructions provided in the respective sections below.

1.1 Install CRISPRme via Conda/Mamba


Note: Conda/Bioconda installs the stable 2.1.x line — for CRISPRme+ 2.4.0 use Docker or source (§1.3).

This section is organized into three subsections to guide you through the installation and maintenance of CRISPRme:

  • Installing Conda or Mamba:
    This subsection provides step-by-step instructions to install either Conda or Mamba. Begin here if you do not have these package managers installed on your machine.

  • Installing CRISPRme:
    Once you have Conda or Mamba set up, proceed to this subsection for detailed instructions on creating the CRISPRme environment and installing the necessary dependencies.

  • Updating CRISPRme:
    Learn how to update an existing CRISPRme installation to the latest version, ensuring access to new features and bug fixes.

1.1.1 Installing Conda or Mamba


Before installing CRISPRme, ensure you have either Conda or Mamba installed on your machine. Based on recommendations from the Bioconda community, we highly recommend using Mamba over Conda. Mamba is a faster, more efficient drop-in replacement for Conda, leveraging a high-performance dependency solver and components optimized in C++.

Step1: Install Conda or Mamba

Step 2: Configure Bioconda Channels

Once Mamba is installed, configure it to use Bioconda and related channels by running the following one-time setup commands:

mamba config --add channels bioconda
mamba config --add channels conda-forge
mamba config --set channel_priority strict

Note: If you prefer to use Conda, replace mamba with conda in the commands above. (Per current Bioconda guidance we do not add the defaults channel, and conda-forge is given the highest priority.)

By completing these steps, your system will be fully prepared for installing CRISPRme.

1.1.2 Installing CRISPRme


CRISPRme+ (2.4.0) runs on Python 3.11 and installs from source — the build compiles CRISPRitz 2.8.1 and installs both tools into a conda environment. A native Bioconda crisprme=2.4.0 package is in preparation; until it lands, the Bioconda crisprme package installs the last stable 2.1.x line (Python 3.8), not this 2.4.0 line.

To create the CRISPRme+ conda environment, follow 1.3 Install CRISPRme from source (git clonemamba env create -f environment.yml (Python 3.11) → bash install_from_source.sh), or use the Docker quickstart for the fastest path.

Verify the installation:

crisprme.py --version
crisprme.py

1.1.3 Updating CRISPRme


To update an existing CRISPRme installation using Mamba or Conda, follow the steps below:

Step 1: Check the Latest Version

Visit the CRISPRme README to identify the latest version of the tool.

Step 2: Update CRISPRme

Run the following command in your terminal, replacing <latest_version> with the desired version number:

mamba install crisprme=<latest_version>

This updates within the stable 2.1.x Bioconda line (latest is crisprme=2.1.14):

mamba install crisprme=2.1.14

For 2.4.0 / CRISPRme+, update via the source build or Docker — there is no Bioconda 2.4.0 package yet. If you're using Conda, replace mamba with conda in the commands above.

Step 3: Verify the Update

After the update completes, ensure the installation was successful by checking the version:

crisprme.py --version

If the displayed version matches the one you installed, the update was successful.

1.2 Install CRISPRme via Docker


This section is organized into two subsections to guide you through the setup of CRISPRme using Docker:

  • Installing Docker:
    Provides step-by-step instructions for installing Docker on your system, ensuring compatibility with all operating systems, including Linux, macOS, and Windows.

  • Building and Pulling CRISPRme Docker Image:
    Explains how to create or download the CRISPRme Docker image to set up a containerized environment for seamless execution.

Follow the subsections in order if Docker is not yet installed on your machine. If Docker is already installed, skip to the second subsection.

1.2.1 Installing Docker


MacOS and Windows users are encouraged to install Docker to use CRISPRme. Linux users may also choose Docker for convenience and compatibility.

Docker provides tailored distributions for different operating systems. Follow the official Docker installation guide specific to your OS:

Apple Silicon (M1/M2/M3) support

The CRISPRme Docker image is now published as a multi-architecture image with a native linux/arm64 build, so it runs natively on Apple Silicon Macs with no emulation (no Rosetta / QEMU, no "platform mismatch" warning). Both the crispritz dependency (native linux-aarch64 bioconda build) and crisprme itself (a noarch package) install per-architecture without any source compilation. Docker automatically selects the correct architecture when you pull or run the image, so no special flags are required.

Docker Desktop memory allocation (important)

CRISPRme's searches are memory intensive. By default Docker Desktop caps the memory available to containers, which can cause searches to fail with out-of-memory errors. Before running large analyses, raise the limit in Docker Desktop → Settings → Resources → Memory16 GB is fine for reference-only runs, but a genome-wide variant search needs 64 GB+ (it peaks at ~68–75 GB). CRISPRme prints a non-fatal WARNING: at the start of a complete-search / complete-test run when it detects less than 32 GB of total memory, reminding you to increase this allocation. (You can override the threshold with CRISPRME_MIN_GB or skip the check entirely with CRISPRME_SKIP_MEM_CHECK=1.)

Linux-Specific Post-Installation Steps

If you're using Linux, additional configuration steps are required:

  1. Create the Docker Group:
sudo groupadd docker
  1. Add Your User to the Docker Group:
sudo usermod -aG docker $USER

Repeat this command for any additional users you want to include in the Docker Group.

  1. Restart Your Machine
    Log out and log back in, or restart your machine to apply the changes.

Testing Docker Installation

Once Docker is installed, verify the setup by opening a terminal window and typing:

docker run hello-world

If Docker is installed correctly, you should see output like this:

Hello from Docker!
This message shows that your installation appears to be working correctly.

To generate this message, Docker took the following steps:
 1. The Docker client contacted the Docker daemon.
 2. The Docker daemon pulled the "hello-world" image from the Docker Hub.
 3. The Docker daemon created a new container from that image, which runs the executable that produces this output.
 4. The Docker daemon streamed this output to the Docker client, which displayed it on your terminal.

For more examples and ideas, visit:
 https://docs.docker.com/get-started/

1.2.2 Building and Pulling CRISPRme Docker Image


After installing Docker, you can download and build the CRISPRme Docker image by running the following command in a terminal:

docker pull pinellolab/crisprme:v2.4.0

This command retrieves the latest pre-built CRISPRme image from Docker Hub and sets it up on your system, ensuring all required dependencies and configurations are included.

Once the download is complete, the CRISPRme Docker image will be ready for use. To confirm the image is successfully installed, you can list all available Docker images by typing:

docker images

Look for an entry similar to the following:

REPOSITORY          TAG       IMAGE ID       CREATED        SIZE
pinellolab/crisprme   v2.4.0    <image_id>     <timestamp>    ~818MB

You are now ready to run CRISPRme using Docker.

1.3 Install CRISPRme from source (without Bioconda)

Use this to run an unreleased line (e.g. 2.4.0, Python 3.11 + Dash 2.x) before it is published to Bioconda, or for development. It installs the runtime dependencies into a conda environment, builds CRISPRitz 2.8.1 from source, and installs CRISPRme from the checkout — using the same layout the Bioconda/Docker builds use, so crisprme.py and crispritz.py end up on your PATH and resolve their support files correctly.

Prerequisites: conda/mamba, git, and internet access. A C++ compiler with OpenMP and every Python dependency are provided by the environment file below (no apt/system packages required).

# 1. clone the repository (2.4.0 development lives on the main branch)
git clone https://github.com/pinellolab/crisprme-plus.git
cd crisprme-plus

# 2. create + activate the runtime environment (pinned deps from environment.yml)
mamba env create -f environment.yml
mamba activate crisprme-2.4.0

# 3. build CRISPRitz 2.8.1 from source and install both tools into the env
bash install_from_source.sh

# 4. verify (both tools are now on your PATH)
crisprme.py --version
command -v crispritz.py

The install_from_source.sh script compiles the CRISPRitz C++ binaries, then copies crisprme.py/crispritz.py into $CONDA_PREFIX/bin and their support trees into $CONDA_PREFIX/opt/…, and unzips the CRISTA scoring model. Override the CRISPRitz tag with CRISPRITZ_REF=<tag> bash install_from_source.sh if needed.

Smoke-test the install (downloads a small chr22 dataset, runs the full pipeline, and compares against the committed ground truth):

mkdir crisprme_test && cd crisprme_test
crisprme.py complete-test --chrom chr22 --thread 4
crisprme.py validate-test --chrom chr22

Notes:

  • This is exactly the recipe the project Dockerfile automates — if you prefer full isolation, build the image instead (Section 1.2).
  • The assembly-search subcommand uses the UCSC liftOver binary, which is included in environment.yml (ucsc-liftover).
  • To launch the web interface after installing: crisprme.py web-interface (serves on port 8080).

2 Usage

CRISPRme is a tool designed for variant- and haplotype-aware CRISPR off-target analysis. It integrates robust functionalities for off-target detection, variant-aware search, and result analysis. The tool also includes a user-friendly graphical interface, which can be deployed locally to streamline its usage.

📄 Preparing inputs? See docs/INPUT_FORMATS.md for PAM/guide file formats, chromosome naming, VCF and annotation requirements, bulge reporting, and how to estimate expensive searches.

2.1 Directory Structure


CRISPRme operates within a specific directory structure to manage input data and outputs efficiently. To ensure proper functionality, your working directory must include the following main subdirectories:

  • Genomes

    • Purpose: Stores reference genomes.
    • Structure: Each reference genome resides in its own subdirectory.
    • Requirements: The genome must be split into separate files, each representing a single chromosome.
  • VCFs

    • Purpose: Contains variant data in VCF format.
    • Structure: Similar to the Genomes directory, each dataset has a dedicated subdirectory with VCF files split by chromosome.
    • Requirements: Files must be compressed using bgzip (with a .gz extension).
  • sampleIDs

    • Purpose: Lists the sample identifiers corresponding to the VCF datasets.
    • Structure: Tab-separated files, one for each VCF dataset, specifying the sample IDs.
  • Annotations

    • Purpose: Provides genome annotation data.
    • Format: Annotation files must be in BED format.
  • PAMs

    • Purpose: Specifies the Protospacer Adjacent Motif (PAM) sequences for off-target search.
    • Format: Text files containing PAM sequences.

The directory organization required by CRISPRme is illustrated below:

crisprme_dirtree.png

2.2 CRISPRme Functions


Running the examples. Each example below is the bare crisprme.py <command> …. To run it in Docker, prefix it with docker run --rm -v "${PWD}:/DATA" -w /DATA -i pinellolab/crisprme:v2.4.0 (add -p 8080:8080 for web-interface). From a source / Conda install, run it as-is inside the activated crisprme-2.4.0 environment.

This section provides a comprehensive overview of CRISPRme's core functions, detailing each feature, the required input data and formats, and the resulting outputs. The following is a summary of CRISPRme's key features:

  • Complete Search (complete-search)
    Executes a genome-wide off-targets search across both reference and variant datasets (if specified), conducts Cutting Frequency Determination (CFD) and CRISTA analyses (if applicable), and identifies candidate targets.

  • Generate Report (generate-report)
    Builds a self-contained, easily shareable off-target assessment report for a completed run — a single ZIP bundling an offline report.html (embedded plots, the top-1000 off-target table, a recommended validation panel), the full integrated_results.tsv.gz, and the per-tier curated TSVs. It runs automatically at the end of every complete-search, and can be re-run standalone on any Results/<jobid> folder.

  • Complete Test (complete-test)
    Tests CRISPRme pipeline on a small input dataset or the full genome, enabling users to validate the tool's functionality before performing large-scale analyses.

  • Off-target sites validation Test (validate-test)
    Validates off-target sites generated by the Complete Test workflow by comparing CRISPRme predictions against brute-force ground-truth alignments derived from 1000 Genomes variant data.

  • Targets Integration (targets-integration)
    Combines in silico predicted targets with experimental data to create a finalized target panel.

  • GNOMAD Converter (gnomAD-converter)
    Transforms GNOMAD VCFs (vcf.bgz format) into a format compatible with CRISPRme. The function supports VCFs from GNOMAD v3.1, v4.0, and v4.1, including joint VCFs.

  • Generate Personal Card (generate-personal-card)
    Generates a personalized summary for a specific sample, identifying all private off-targets unique to that individual.

  • Setup Legacy Database (setup)
    Initializes the CRISPRme legacy database by downloading reference genomes, variant datasets, PAM definition files, and all associated resources originally distributed through the CRISPRme web server. The downloaded resources can be reused across analyses, eliminating the need for repeated downloads and simplifying environment setup.

  • Web Interface (web-interface)
    Launches CRISPRme's interactive web interface, allowing users to manage and execute tasks directly via a local browser.

2.2.1 Complete Search


The Complete Search function performs an exhaustive variant- and haplotype-aware off-target analysis, leveraging the provided reference genome and variant datasets to deliver comprehensive results. This feature integrates all critical stages of the CRISPRme pipeline, encompassing off-target identification, functional annotation, and detailed reporting.

Quickstart (batteries install). After the Docker quickstart download, a variant-aware search is a single command — download --what index already wrote the list_vcf.txt / list_samplesID.txt the search reads, and the guide is auto-padded to the PAM:

printf '%s\n' ACTGAAATCTGTAAGCAGGC > my_guide.txt
docker run --rm -v "${PWD}:/DATA" -w /DATA pinellolab/crisprme:v2.4.0 \
  crisprme.py complete-search \
    --genome Genomes/hg38 --pam PAMs/20bp-NRG-SpCas9.txt \
    --guide my_guide.txt --vcf list_vcf.txt --samplesID list_samplesID.txt \
    --annotation Annotations/dhs+encode_screenv4+gencode+cosmic.hg38.bed.gz \
    --gene_annotation Annotations/gencode.protein_coding.bed.gz \
    --mm 4 --bDNA 1 --bRNA 1 --output my_search --thread 4
# shareable report: crisprme.py generate-report --result-dir Results/my_search

The example below shows every argument (a classic setup with a custom VCF config file and base-editing options); see the CLI guide for each one.

Usage Example for the Complete Search function:

crisprme.py complete-search \
  --genome Genomes/hg38 \
  --vcf vcf_config.1000G.HGDP.txt \
  --guide sg1617.txt \
  --pam PAMs/20bp-NRG-SpCas9.txt \
  --annotation Annotations/dhs+encode_screenv4+gencode+cosmic.hg38.bed.gz \
  --gene_annotation Annotations/gencode.protein_coding.bed \
  --samplesID samplesIDs.1000G.HGDP.txt \
  --be-window 4,8 \
  --be-base A,G \
  --mm 4 \
  --bDNA 1 \
  --bRNA 1 \
  --merge 3 \
  --sorting-criteria-scoring mm+bulges \
  --sorting-criteria mm,bulges \
  --output sg1617-NGG-1000G-HGDP \
  --thread 8

(Each argument is documented under Input Arguments below.)

Input Arguments

Below is a detailed list of the input arguments required or optionally used by the Complete Search function. Each parameter is explained to ensure clarity in its purpose and usage:

General Parameters

  • --help
    Displays the help message with usage details and exits. Useful for quickly referencing all available options.

  • --output (Required)
    Specifies the name of the output directory where all results from the analysis will be saved. This directory will be created within the Results directory.

  • --thread (Optional - Default: 8)
    Defines the number of CPU threads to use for parallel computation. Increasing the number of threads can speed up analysis on systems with multiple cores.

  • --debug (Optional)
    Runs the tool in debug mode.

Input Data Parameters

  • --genome (Required)
    Path to the directory containing the reference genome in FASTA format. Each chromosome must be in a separate file (e.g., chr1.fa, chr2.fa, etc.).

  • --vcf (Optional)
    Path to text config file listing the directories containing VCF files to be integrated into the analysis. When provided, CRISPRme conducts variant- and haplotype-aware searches. If not specified, the tool searches only on the reference genome.

  • --guide
    Path to a text file containing one or more guide RNA sequences (one per line) to search for in the input genome and variants. This argument cannot be used together with --sequence.

  • --sequence
    Path to a FASTA file listing guide RNA sequences. This argument is an alternative to --guide and cannot be used simultaneously.

  • --pam (Required)
    Path to a text file specifying the PAM sequence(s) required for the search. The file should define the PAM format (e.g., NGG for SpCas9).

Annotation Parameters (Optional)

  • --annotation
    Path to a BED file containing genomic annotations, such as regulatory regions (e.g., DNase hypersensitive sites, enhancers, promoters). These annotations provide functional context for identified off-targets.

  • --gene_annotation
    Path to a BED file containing gene information, such as Gencode protein-coding annotations. This is used to calculate the proximity of off-targets to genes for downstream analyses.

Base Editing Parameters (Optional)

  • --be-window
    Specifies the editing window for base editors, defined as start and stop positions relative to the guide RNA (1-based, comma-separated). This defines the region of interest for base-editing analysis.

  • --be-base
    Defines the target nucleotide(s) for base editing. This is only used when base editing functionality is needed.

Sample-Specific Parameters (Optional)

  • --samplesID
    Path to a text config file listing sample identifiers (one per line) corresponding to VCF datasets. This enables sample-specific off-target analyses. Mandatory if --vcf is specified.

Search and Merging Parameters

  • --mm (Required)
    Maximum number of mismatches allowed during off-target identification.

  • --bDNA (Optional, default derived from --max-total-edits)
    Maximum allowable DNA bulge size. If omitted (together with --bRNA), it is derived from --max-total-edits, capped by the bulge depth the installed index supports — so --max-total-edits acts as a single "max edits" knob. Pass it explicitly to override. If no bulge-capable index is installed the search stays bulge-free.

  • --bRNA (Optional, default derived from --max-total-edits)
    Maximum allowable RNA bulge size. See --bDNA — the two are derived together from --max-total-edits when neither is given.

  • --max-total-edits (Optional, default 4)
    Cap on the combined number of edits (mismatches + DNA/RNA bulges) considered per candidate off-target, and — when --bDNA/--bRNA are omitted — the budget the per-type bulge caps are derived from. Lower values speed up dense-variant searches; raise it to recover targets with many simultaneous edits. -1 disables the cap.
    NOTE: for a variant-created off-target you must also pass --vcf (or use a precomputed variant index); a reference-only search will not surface it regardless of this value.

  • --merge (Optional - Default: 3)
    Defines the window size (in base pairs) used to merge closely spaced off-targets. Pivot targets are selected based on the highest score (e.g., CFD, CRISTA) or criteria defined by the --sorting-criteria.

  • --sorting-criteria-scoring (Optional - Default: mm+bulges)
    Specifies sorting criteria for merging when using CFD/CRISTA scores. Options include:

    • mm: Number of mismatches.
    • bulges: Total bulge size.
    • mm+bulges: Combined mismatches and bulges.
  • --sorting-criteria (Optional - Default: mm+bulges,mm)
    Sorting criteria used when CFD/CRISTA scores are unavailable. Options are similar to --sorting-criteria-scoring but tailored for simpler analyses.

Note 1: Ensure compatibility between input files and genome builds (e.g., hg38 or hg19) to avoid alignment issues.

Note 2: Optional arguments can be omitted when not applicable, but required arguments must always be specified.

Output Data Overview

The Complete Search function generates a comprehensive suite of reports, detailing the identified and prioritized targets, along with statistical and graphical summaries. These outputs are essential for interpreting the search results and understanding the impact of genetic diversity on CRISPR off-target.

Output Off-targets Files Description

  1. *.integrated_results.tsv

    • Contents: A detailed file containing the top targets (*.bestMerge.txt) enriched with annotations from the input files. Includes:

      • Gene proximity of off-targets
      • Overlaps with regulatory elements
    • Purpose: Integrates functional genomic context into the prioritization of off-targets.

  2. *.all_results_with_alternative_alignments.tsv

    • Contents: Comprehensive listing of all identified targets, including alternative alignments. Annotated with:

      • Gene proximity
      • Overlaps with regulatory elements
    • Purpose: Facilitates a full exploration of CRISPRme's off-target predictions and their functional relevance.

Guide-Specific Summary Files

These files summarize off-target statistics per guide sequence based on different sorting criteria.

  1. *.summary_by_guide.<guide-sequence>_CFD.txt

    • Contents: Summarizes off-target counts per guide using the CFD score as the primary sorting criterion (data derived from *.integrated_results.tsv). Includes counts of:

      • Targets by bulge type (DNA, RNA).
      • Mismatch number and bulge size.
      • Targets in the reference genome, variant genome, and those caused by PAM creation due to variants.
    • Purpose: Provides insight into the distribution and characteristics of off-targets prioritized by CFD score.

  2. *.summary_by_guide.<guide-sequence>_CRISTA.txt

    • Contents: Summarizes off-target counts per guide using the CRISTA score as the primary sorting criterion (data derived from *.integrated_results.tsv). Includes counts of:

      • Targets by bulge type (DNA, RNA).
      • Mismatch number and bulge size.
      • Targets in the reference genome, variant genome, and those caused by PAM creation due to variants.
    • Purpose: Provides insight into the distribution and characteristics of off-targets prioritized by CRISTA score.

  3. *.summary_by_guide.<guide-sequence>_fewest.txt

    • Contents: Summarizes off-target counts per guide using the fewest mismatches and bulges as the sorting criterion.

    • Purpose: Highlights off-targets that are closest to perfect matches, providing an alternative prioritization method.

Sample-Specific Summary Files

These files focus on off-targets unique to individual samples and their populations.

  1. *.summary_by_samples.<guide-sequence>_CFD.txt

    • Contents: Counts of private off-targets per sample, sorted by CFD score. Reports targets:

      • Private to the sample.
      • Found in the population or superpopulation.
      • Resulting from PAM creation due to a variant.
    • Purpose: Quantifies sample-specific off-targets and their broader population impact.

  2. *.summary_by_samples.<guide-sequence>_CRISTA.txt

    • Contents: Similar to the CFD-based sample summary but uses CRISTA score for sorting.
  3. *.summary_by_samples.<guide-sequence>_fewest.txt

    • Contents: Summarizes private off-targets using the fewest mismatches and bulges as the sorting criterion.

Graphical Output

  1. imgs directory

    • Contents: Contains visual representations of the top 1000 targets based on CFD score, CRISTA score, and Fewest mismatches and bulges. Images include:

      • Bar plots showing the distribution of targets across populations and bulge types.
      • Graphical summaries illustrating the impact of genetic variants on mismatches, bulge size, and scores.
    • Purpose: Facilitates easy interpretation and presentation of CRISPRme results.

2.2.2 Complete Test


The Complete Test module provides an automated pipeline for verifying the correct installation and functionality of CRISPRme. This feature is designed to simplify the validation process by automatically setting up the required directory structure, downloading essential files, and offering flexible testing options tailored to different user needs.

This function automatically creates the CRISPRme directory structure required for the tool to function properly. Furthermore, it downloads and prepares all necessary files for testing, ensuring that users do not need to manually manage dependencies. Complete Test module allows users to perform a test limited to a specific chromosome (e.g., chromosome 22), significantly reducing runtime and resource usage. However, is also available the option to test on the entire genome, ensuring all components of CRISPRme work correctly across large-scale datasets. This function supports testing with 1000 Genomes Phase 3 dataset and Human Genome Diversity Project (HGDP) dataset. Testing parameters, such as the genome dataset and test type, can be customized via command-line arguments, allowing users to tailor the testing process to their system capabilities and goals.

This module is suited for:

  • Initial Installation Verification: Test whether CRISPRme has been installed correctly and is functioning as expected before running actual analyses.

  • System Configuration Testing: Validate the compatibility of CRISPRme with different system configurations (e.g., varying thread counts, datasets).

  • Dataset Evaluation: Test specific datasets (1000 Genomes Phase 3 or HGDP) to confirm their suitability for the user’s research needs.

Usage Example for the Complete Test function:

crisprme.py complete-test \
  --chrom chr22 \
  --vcf_dataset 1000G
Input Arguments

Below is a detailed list of the input arguments required by the Complete Test function, including detailed explanations and default behaviors:

General Parameters

  • --help
    Displays the help message with details about the available options and exits the program.

  • --thread (Optional - Default: 4)
    Specifies the number of threads to use for the computation, allowing for parallel processing.

  • --debug (Optional)
    Runs the tool in debug mode.

Input Data Parameters (Optional)

  • --chrom
    Specifies the chromosome to be used in the CRISPRme test. The chromosome identifier must be prefixed with chr (e.g., chr22). When this argument is provided, the test will be limited to the specified chromosome, enabling faster execution for targeted validation. Default behavior: Run the test across the entire genome.

  • --vcf_dataset
    Defines the variant dataset to be utilized for testing CRISPRme. Available options include:

    • 1000G: Uses the 1000 Genomes Phase 3 dataset.

    • HGDP: Uses the Human Genome Diversity Project dataset.

    Default behavior: Use 1000 Genomes variant data.

Output Data Overview

The results generated by the Complete Test function are saved in a subdirectory within the Results directory, named crisprme-test-out.

The output folder contains the same set of files produced by the Complete Search functionality, including:

  • Detailed target reports that prioritize off-target candidates based on various criteria.

  • Summaries categorized by guides and samples.

  • Graphical representations of results, such as bar plots and impact assessments of genetic variants on target metrics.

For a detailed description of the contents of these files, please refer to the corresponding subsection in Complete Search.

Finally, the off-target sites generated by the Complete Test workflow can be validated using the Off-Target Sites Validation Test functionality, which compares CRISPRme predictions against brute-force ground-truth results. For additional details on this validation step, refer to the Off-Target Sites Validation Test section in the documentation.

2.2.3 Off-Target Sites Validation Test


The Validate Test functionality provides a systematic validation of off-target sites generated by the Complete Test workflow in CRISPRme. This module evaluates the correctness and completeness of CRISPRme’s variant-aware off-target predictions by comparing them against results obtained through a brute-force search and alignment strategy, serving as a ground-truth reference.

The validation step is designed to ensure robustness and reliability of the pipeline, particularly when working with large-scale population variant data.

⚠️ Important Requirements

  • The complete-test functionality must be executed beforehand
  • Validation is supported only when complete-test was run using 1000 Genomes Project variant data

Usage Example for the Off-Target Sites Validation Test function:

crisprme.py validate-test \
  --chrom chr22

If no chromosome is specified, validation is performed across all chromosomes available from the prior complete-test execution.

Input Arguments

Below is a detailed list of the input arguments supported by the Off-Target Sites Validation Test function, including their purpose and default behavior:

General Parameters

  • --help
    Displays the help message with details about the available options and exits the program.

  • --debug (Optional)
    Runs the tool in debug mode.

Validation Parameters

  • --chrom (Optional)
    Restricts validation to a specific chromosome (e.g., chr22). If not provided, validation is performed across all chromosomes processed during the complete-test run.
Output Data Overview

The Off-Target Sites Validation Test functionality does not generate new result files. Instead, it performs an in-place validation of the off-target sites produced by the Complete Test workflow and reports the outcome directly through standard output and error streams.

At completion, the Off-Target Sites Validation Test produces a validation summary that includes:

  • Confirmation of a successful validation when the CRISPRme and brute-force off-target sites match exactly.
  • Detailed diagnostics in case of discrepancies, including:
    • Total number of off-target sites in each set
    • Number of sites missing from CRISPRme predictions
    • Number of extra sites detected only by CRISPRme
    • Example mismatched sites to aid debugging

2.2.4 Targets Integration


The Targets Integration function enables the seamless combination of computationally predicted off-targets identified by CRISPRme with experimentally validated off-targets, such as those obtained from GUIDE-seq, CIRCLE-seq, or other high-throughput methods. This integration enhances the interpretability and reliability of CRISPRme’s results by merging empirical data with in silico predictions.

This module supports integration with user-provided datasets in BED format, enabling flexibility in validation sources. Targets Integration

Usage Example for the Targets Integration function:

Note: the --output folder must already exist — targets-integration errors out if it does not. Create it first with mkdir -p.

mkdir -p integrated_targets_dir
crisprme.py targets-integration \
  --targets results.integrated_results.tsv \
  --empirical_data empirical_data.bed \
  --output integrated_targets_dir
Input Arguments

Below is a detailed list of the input arguments required by the Target Integration function, including detailed explanations and default behaviors:

General Parameters

  • --help
    Displays the help message with details about the available options and exits the program.

Input Data Parameters

  • --targets (Required)
    Specifies the file containing targets identified and processed from a CRISPRme search. This file should include predicted off-target data such as mismatch counts, bulge sizes, and scores (e.g., CFD, CRISTA).

  • --empirical_data (Required)
    Path to a BED file containing empirically validated off-targets. This file typically includes genomic coordinates and additional metadata from experiments such as GUIDE-seq or CIRCLE-seq. Ensure that the BED file format adheres to standard conventions for compatibility.

  • --output (Required)
    Name of the directory where the resulting integrated targets file will be saved.

Output Data Overview

The Targets Integration module generates output files that merge computationally predicted targets from CRISPRme with experimentally validated off-targets provided in the BED file. The integrated data is stored in the specified output directory and includes the integrated_results.tsv. This tab-separated file contains the combined list of off-target sites. Each entry represents a merged record from CRISPRme predictions and empirical data, where overlaps are identified based on genomic coordinates.

2.2.5 GNOMAD Converter


The GNOMAD Converter function is a utility designed to preprocess and convert GNOMAD VCF files into a format compatible with CRISPRme for off-target analysis. This tool facilitates the inclusion of population-level genetic variation data from GNOMAD into CRISPRme.

The converter currently supports VCF files from the following GNOMAD versions:

  • v3.1
  • v4.0
  • v4.1, including joint VCF files (exomes + genomes).

Since individual sample data are not available in GNOMAD VCFs, the tool relies on population-level groupings. Populations are treated as individual "samples" for the purpose of conversion. This approach supports population-based statistical analyses in CRISPRme, such as identifying population-specific off-targets.

Note 1: For studies requiring sample-specific statistics, GNOMAD is not recommended due to its population-level nature.

Note 2: The GNOMAD Converter function is particularly useful for creating GNOMAD-compatible datasets formatted for CRISPRme's population-aware off-target analysis.

Note 3: Since GNOMAD provides population-level data rather than individual-level data, CRISPRme interprets populations as pseudo-individuals. This approach allows meaningful population-level statistics but is not suitable for applications requiring individual-level granularity.

To ensure a smooth conversion process, sample ID files compatible with GNOMAD VCFs must be provided. These files are available for download from the CRISPRme GitHub repository:

The conversion process preserves all variant information necessary for CRISPRme analyses, including allele frequencies and genotypes (if applicable).

Usage Example for the GNOMAD Converter function:

crisprme.py gnomAD-converter \
  --gnomAD_VCFdir gnomad_vcf_dir \
  --samplesID samplesIDs.gnomad.v41.txt \
  --keep \
  --threads 4
Input Arguments

Below is a detailed list of the input arguments required by the GNOMAD Converter function, including detailed explanations and default behaviors:

General Parameters

  • --help
    Displays the help message with details about the available options and exits the program.

  • --threads (Optional - Default: 8)
    Specifies the number of threads to use for the conversion, allowing for parallel processing.

  • --debug (Optional)
    Runs the tool in debug mode.

Input Data Parameters

  • --gnomAD_VCFdir (Required)
    Specifies the directory containing the gnomAD VCF files to be processed and converted into a format compatible with CRISPRme.

  • --samplesID (Required)
    Path to a text file containing the sample IDs used during the conversion process. In this file, GNOMAD populations are treated as pseudo-individual samples to create population-based VCFs for CRISPRme.

  • --joint (Optional)
    Use this flag if GNOMAD VCFs being processed are joint VCFs, such as GNOMAD v4.1 joint variant files. Default Behavior: Assumes the input VCFs are not joint.

  • --keep (Optional)
    Use this flag to retain all variants during the conversion, regardless of the FILTER field value. Default behavior: Excludes variants that do not have a PASS value in the FILTER field.

  • --multiallelic (Optional)
    Indicates whether to merge variants at the same genomic position into a single multiallelic record. Default behavior: Keeps variants as biallelic and does not merge them.

Output Data Overview

The output of the GNOMAD Converter function consists of converted VCF files formatted to be compatible with CRISPRme. These files are stored in the same directory as the input VCF files. The conversion process ensures that the output adheres to CRISPRme's input specifications for population-level analysis. Below are details about the generated data:

File Naming Conventions

  • Multiallelic Variant Merging (--multiallelic)
    If multiallelic entries were generated by merging variants at the same position, the filename will include a tag such as *.multiallelic.*, *.biallelic.* otherwise.

  • Joint Variant Files (--joint)
    If joint VCFs were processed, the filenames will be labeled accordingly, for example, *.joint.*.

Content of the Converted VCFs

  • Population Representation
    Each output VCF treats GNOMAD populations as pseudo-individual samples, enabling CRISPRme to perform population-based statistical analysis. This structure is reflected in the sample columns of the output VCFs.

  • Variant Quality
    If the --keep flag is used, all variants from the input VCF are included, regardless of their quality as indicated in the FILTER field. Without the --keep flag, only variants with a PASS in the FILTER field are retained.

  • Allele Representation
    By default, the converter preserves biallelic representation, creating one row per variant. If the --multiallelic flag is used, variants at the same position are merged into multiallelic entries.

  • Compatible Structure
    The output files are structured to align with CRISPRme's population-aware off-target analysis, ensuring seamless integration into the tool's pipeline.

2.2.6 Generate Personal Card


The Generate Personal Card functionality creates a sample-specific report, referred to as personal card. This report details all off-targets identified by CRISPRme for a given sample's unique genomic sequence. The report accounts for private variants (genetic differences specific to the sample not shared with other populations or individuals) and their potential impact on off-target editing outcomes.

This feature is particularly useful in scenarios where personalized gene-editing strategies are required, such as analyzing how private genetic variations influence the efficacy and safety of CRISPR-based interventions. The personal card provides the following key insights:

  • Identification of off-target sequences present exclusively in the sample due to private variants. This allows researchers to evaluate potential risks or opportunities unique to the individual’s genome.

  • Detailed information for each input guide, showing how private variants affect off-target sequences.

This functionality is a critical tool for advancing personalized medicine and precision genome editing, enabling researchers and clinicians to tailor CRISPR-based solutions to an individual’s unique genetic makeup.

Usage Example for the Generate Personal Card function:

crisprme.py generate-personal-card \
  --result_dir Results/sg1617.4.1.1 \
  --guide_seq CTAACAGTTGCTTTTATCACNNN \
  --sample_id NA21129
Input Arguments

Below is a detailed list of the input arguments required by the Generate Personal Card function, including detailed explanations and default behaviors:

General Parameters

  • --help
    Displays the help message with details about the available options and exits the program.

  • --debug (Optional)
    Runs the tool in debug mode.

Input Data Parameters

  • --result_dir (Required)
    Specifies the directory containing the CRISPRme search results. The tool extracts the relevant targets from the reports available in this directory. Ensure this path includes all necessary output files generated by CRISPRme during the analysis (*.integrated_results.*).

  • --guide_seq (Required)
    The sgRNA sequence for which the sample-specific targets will be extracted. This argument ensures that the generated personal card is tailored to a specific guide of interest, enabling targeted analysis.

  • --sample_id (Required)
    The identifier of the sample for which the personal card will be created. This ID corresponds to the unique genetic profile being analyzed. Ensure the sample ID matches the format used in the input data to avoid discrepancies.

Output Data Overview

The Generate Personal Card functionality produces sample-specific outputs, allowing researchers to assess how private genetic variants influence CRISPR off-target activity.

Note 1: All output files include the sample ID in their file names for easy identification and traceability (e.g., *.<sample_id>.*).

Note 2: Outputs are tailored to the specified guide sequence and sample ID, ensuring precise and personalized reporting.

Output Off-targets Files description

  • *.<sample_id>.<guide_seq>.private_targets.tsv
    A detailed table reporting all off-target sequences specific to the sample. Extracted from the .integrated_results. file within the input directory. The report is generated in the results directory specified via --result_dir.

Graphical Output

  • imgs directory
    The function generates plots illustrating the effect of private genetic variants on the sample-specific targets. Displays changes in the CFD and
    CRISTA scores, and number of Mismatches and Bulges highlighting off-target risk influenced by genetic variants.

2.2.7 Setup Legacy Database


The Setup Legacy Database functionality initializes the CRISPRme legacy database by downloading all reference genomes, variant datasets, PAM definition files, and associated resources originally distributed through the CRISPRme web server.

This functionality provides a convenient way to reproduce the original CRISPRme environment and ensures that all required resources are available locally before running analyses. Once downloaded, the resources can be reused across multiple analyses without requiring additional downloads, reducing setup time and improving reproducibility.

This feature is particularly useful when deploying CRISPRme on new systems, setting up shared computational environments, or preparing offline analysis workflows. The setup process provides the following key benefits:

  • Automated download and organization of all required reference resources, eliminating the need for manual retrieval and configuration.
  • Support for downloading either the complete database or chromosome-specific resources, allowing users to reduce storage requirements when working on targeted analyses.
  • Reuse of downloaded resources across multiple CRISPRme runs, avoiding redundant downloads and ensuring consistent analysis environments.

This functionality serves as the foundation for CRISPRme analyses by providing all reference data and auxiliary resources required by downstream workflows.

Usage Example for the Setup Legacy Database function:

crisprme.py setup \
  --path CRISPRme_database
Input Arguments

Below is a detailed list of the input arguments supported by the Setup Legacy Database function, including detailed explanations and default behaviors:

General Parameters

  • --help
    Displays the help message with details about the available options and exits the program.
  • --debug (Optional)
    Runs the tool in debug mode.

Database Configuration Parameters

  • --path (Optional)
    Specifies the directory where the CRISPRme legacy database and all associated resources will be downloaded and installed. If not provided, the current working directory is used.
  • --chrom (Optional)
    Downloads resources associated with a specific chromosome only (for example, chr22). This option can significantly reduce download time and storage requirements when testing or performing chromosome-restricted analyses. By default, resources for all chromosomes are downloaded.
  • --force (Optional)
    Forces the download of all resources even if an existing CRISPRme database is already detected in the specified installation directory. This option is useful when repairing incomplete installations or refreshing previously downloaded data.
Output Data Overview

The Setup Legacy Database functionality creates a local CRISPRme database containing all resources required for downstream analyses.

Note 1: The exact directory structure depends on the resources available from the CRISPRme legacy repository and the selected download options.

Note 2: Downloaded resources are preserved and can be reused across multiple CRISPRme analyses without requiring additional setup steps.

Downloaded Resources

  • Reference genome files
    Genome assemblies required by CRISPRme for off-target identification and genomic coordinate annotation.
  • Variant datasets
    Population-scale variant collections used to perform variant-aware off-target searches and population analyses.
  • PAM definition files
    Configuration files describing PAM sequences and nuclease-specific targeting rules supported by CRISPRme.
  • Auxiliary resources
    Additional metadata, indexes, and support files required by CRISPRme workflows and analysis modules.

Output Directory

  • Installation directory specified by --path
    Contains the complete CRISPRme legacy database organized in a structure compatible with all CRISPRme analysis workflows.

2.2.8 Local Web Interface


The Web Interface module offers a user-friendly, locally hosted graphical user interface (GUI) for CRISPRme. This interface enables users to execute CRISPRme workflows and explore results interactively through a web browser, without requiring any external web service. This interface provides a complete interactive environment for running CRISPRme analyses locally.

The GUI allows users to submit CRISPRme jobs directly through the web interface. Users can upload input files, configure parameters, and monitor progress with ease.

The interface provides an intuitive way to explore the output files generated by CRISPRme. Users can filter targets by criteria such as mismatch count, bulge size, or scores (e.g., CFD or CRISTA). The interface includes dynamic plots and charts. Results are presented in a structured, easy-to-navigate format, linking data to relevant genomic annotations. The web interface runs as a local server, ensuring data privacy and fast response times. Users can access it via their preferred web browser, with compatibility confirmed for: Google Chrome, Mozilla Firefox, and Safari. All functionalities are self-contained, eliminating the need for an internet connection. This is particularly useful for secure environments or systems without reliable internet access.

Usage example for the Web Interface function:

crisprme.py web-interface

🌐 Accessing the interface from another machine (SSH tunnel). The server binds IPv4 0.0.0.0:8080. When forwarding it over SSH from a remote host, use the explicit IPv4 address as the forward target — localhost may resolve to IPv6 (::1) and be refused:

ssh -N -L 8080:127.0.0.1:8080 user@remote-host   # then open http://localhost:8080
Input Arguments

Below is a detailed list of the input arguments required by the Web Interface function:

  • --help
    Displays the help message and exits.

  • --debug (Optional)
    Launches the local server in debug mode. This mode enables verbose logging, which is useful for troubleshooting and diagnosing issues during setup or operation. It provides detailed error messages and runtime information in the console.

Output Data Overview

This function does not generate output data in the form of files or reports. Instead, it serves to launch a local graphical user interface, which allows users to interactively explore and run CRISPRme analyses. All results are displayed dynamically within the web interface itself, offering an interactive experience for viewing CRISPRme data and outputs (see Section 2.2.1 for details).

2.2.9 Generate Report


The Generate Report function (generate-report) builds a self-contained, easily shareable off-target assessment report for a completed CRISPRme run. It produces a single ZIP (<jobid>_report.zip) in which report.html is the only top-level file — open it — while every bundled data file (the full integrated_results.tsv.gz, the top-1000 / top-100 validation-panel tables, the non-empty per-tier curated TSVs, and the high-variant-density BED) sits under a data/ subfolder. report.html is fully offline (plots embedded as base64 PNGs, the top-1000 table + CSS inline, no external dependencies), and every filename it mentions links to its bundled file under data/. It is a portable digest of the full interactive website result, aimed at sharing off-target predictions (for example, to design a targeted-NGS / rhAMP-Seq confirmation panel).

This report is generated automatically at the end of every complete-search run, so most users never call it directly. Run it standalone only to (re)generate the ZIP for an existing result folder.

Usage Example for the Generate Report function:

crisprme.py generate-report \
  --result-dir Results/my-job
How to read the report

Unzip and open report.html (the only file at the top level; everything else is under data/). Reading top to bottom:

  • 1. Summary — run parameters and an off-target-by-mismatch/bulge matrix. The Analysis inputs & criteria box's Variants included line states the genotyped panel size (e.g. 3,477 individuals for 1000G+HGDP) and the number of SNPs and indels searched.
  • ⚠ Red banner ("no unambiguous on-target") — appears when a guide has more than one perfect (0-mismatch / 0-bulge) match: there is then no a-priori on-target, so every perfect-match site is listed, flagged Perfect_match = Yes, and forced to the top of the validation panel. (One perfect match = a normal amber "presumed on-target" note instead.)
  • 4. Recommended validation panel — CFD / CRISTA / edit-distance threshold tables plus a hybrid worst-case ~100-site panel (data/panel_top100.tsv) to seed a targeted-NGS / rhAMP-Seq confirmation assay.
  • MAF column — a value of 1e-05 is a display floor meaning "present but frequency effectively 0" (used so a zero-frequency allele still renders on the log-scale plots), not a measured frequency.
Input Arguments

  • --result-dir (Required unless --integrated-results is given)
    A CRISPRme result folder (Results/<jobid>). The integrated-results TSV, .Params.txt, .version.txt and the default output location are resolved from here.

  • --integrated-results (Optional)
    An explicit integrated_results TSV (.tsv or .tsv.gz) to report on, instead of resolving it from --result-dir.

  • --samplesID-dir (Optional)
    Directory of samplesID files used for the superpopulation breakdown plot; auto-detected near the install when omitted.

  • --output (Optional)
    Output ZIP path. Defaults to <result-dir>/<jobid>_report.zip.

2.2.10 Reference-Index and Data-Distribution Commands

Bulge-enabled searches build a CRISPRitz index of the reference genome. complete-search does this automatically on the first run and reuses it afterward, but three commands let you control it explicitly — useful for batch jobs, shared clusters, and skipping the build via prebuilt indexes.

build-index-only — build the reusable reference index (into genome_library/<PAM>_<bulges+1>_<genome>) without running a search. Pass the same --genome/--pam/--bDNA/--bRNA you will search with:

crisprme.py build-index-only --genome Genomes/hg38 --pam PAMs/20bp-NRG-SpCas9.txt --bDNA 2 --bRNA 2 --thread 16 --path /data/crisprme

This writes genome_library/NRG_3_hg38 (the folder number is max(bDNA,bRNA)+1, so 2 bulges → _3_), which is the same index shipped precomputed on HuggingFace.

Add --vcf (a VCF dataset directory) to also pre-build the variant-aware index (genome enrichment + SNP/indel indexes). Add --samplesID (a listing file, one samplesID filename per line under samplesIDs/; a combined panel lists both 1000G and HGDP) to make it self-complete: with --samplesID the build ALSO emits the dict-less Tier-0 registry + Tier-1 genotype tiers and, for a merged panel, writes the combined samplesIDs/<vcf>.samplesID.txt list. Without --samplesID you get a dicts-only index (no fast post-analysis).

crisprme.py build-index-only --genome Genomes/hg38 --pam PAMs/20bp-NRG-SpCas9.txt --bDNA 2 --bRNA 2 --vcf VCFs/hg38_1000G_HGDP --samplesID samplesIDs.config.txt --path /data/crisprme

complete-search --index-path <dir> — reuse a prebuilt/staged index library instead of building one under the working directory. A missing matching index is a hard error (rather than a silent rebuild), which is what you want on a read-only shared mount.

download — fetch reference data from a HuggingFace dataset repository over HF's CDN (typically much faster than the FTP/UCSC sources). --what selects the component: genome, annotations, pams, samples, vcf (with --dataset), index (with --index-name), or all (genome + annotations + PAMs + samples; on hg38 all also fetches the default NRG_3_hg38 reference index so a reference scan works with no on-demand build). For --what index, --no-genotypes skips the big separate Tier-1 genotype store; the Tier-0 registry it keeps still corrects allele frequencies and rsIDs, but per-individual Samples and variant off-target rows require the genotype tier — omit --no-genotypes for full dict-less variant-aware output. Default repo lucapinello/crisprme-data, overridable with --hf-repo or CRISPRME_HF_REPO:

crisprme.py download --what all --path /data/crisprme
crisprme.py download --what vcf --dataset 1000G --path /data/crisprme
crisprme.py download --what index --index-name NRG_3_hg38 --path /data/crisprme
crisprme.py download --what index --index-name NRG_3_hg38-dictless+hg38_1000G_HGDP --path /data/crisprme

publish-index — upload a locally built index to a HuggingFace dataset repository so other machines can skip the build (needs an HF write token via --token or HF_TOKEN). Add --dictless for a variant index to drop the ~152 GB per-sample SNP dicts (the registry + genotype tiers replace them; indel logs kept), upload the genotype store as a separate companion, and bundle the samplesID lists so the index is self-complete:

crisprme.py publish-index --index genome_library/NRG_3_hg38
crisprme.py publish-index --index genome_library/NRG_3_hg38+hg38_1000G_HGDP --dictless

See the companion data-setup guide (docs/crisprme_data_setup_051826.md, Sections 2d and 3½) for the end-to-end workflow.

3 Test

This section covers CRISPRme testing. This ensures that the software is correctly installed, configured, and ready for use. This section covers two testing options tailored to user needs:

  • Quick Test
    A lightweight test to verify the installation and basic functionality.

  • Detailed Test
    A comprehensive pipeline test, replicating a full-scale CRISPRme analysis.

For persistent issues, refer to the CRISPRme GitHub Issues Page or contact the maintainers.

3.1 Quick Test


The Quick Test provides a simple and efficient way to confirm that CRISPRme is correctly installed and operational on your system. It ensures that the software is accessible, dependencies are properly configured, and the version matches the expected release.

Step 1: Verify CRISPRme Installation

Open a terminal and execute the following command to check the software version:

crisprme.py --version

If the output displays the correct software version (e.g., v2.4.0), CRISPRme is successfully installed and ready for use.

Step 2: Access CRISPRme Help Menu

To explore the functionalities and input parameters of CRISPRme, use the --help flag:

crisprme.py

The help menu provides detailed descriptions of CRISPRme's features and usage instructions, enabling users to familiarize themselves with available options and workflows.

Why Perform the Quick Test?

The Quick Test is highly recommended:

  1. Immediately after installation to ensure the setup is correct.

  2. Before running full-scale analyses to verify dependencies and environment configurations.

If the Quick Test completes without errors, you can confidently proceed to detailed analyses using CRISPRme’s powerful tools and features.

3.2 Detailed Test


For a more comprehensive validation of CRISPRme’s functionality, this detailed test offers a full-scale test of the main CRISPRme pipeline, specifically its Complete Search module. This test provides two distinct options for testing: a quicker, focused test on a single chromosome and a more detailed, exhaustive test across the entire genome:

  • Single Chromosome Test
    This test runs a search for potential off-targets on a single chromosome, such as chromosome 22, enriched with variants from the 1000 Genomes or Human Genome Diversity Project (HGDP) datasets. This provides a fast way to check CRISPRme's ability to process variant data and identify off-targets for a specific chromosome.

  • Full Genome Test
    This test checks CRISPRme's ability to search for potential off-targets across the entire human genome. It runs a search using the sg1617 guide RNA with an NGG PAM site, incorporating both Gencode and ENCODE annotations to ensure comprehensive results.

Upon successful completion of the Complete Test, users may optionally perform an additional off-target validation step using the Off-Target Sites Validation Test functionality. This step compares CRISPRme-predicted off-targets against brute-force ground-truth alignments derived from 1000 Genomes variant data, providing a rigorous correctness check of the pipeline.

Why Perform the Detailed Test?

The Detailed Test is ideal for users who wish to:

  • Fully assess CRISPRme’s performance across the genome.
  • Perform a more comprehensive check on CRISPRme’s ability to handle large-scale data and complex analyses.
  • Validate CRISPRme’s off-target predictions against brute-force results using the Validate Test functionality.

Successful completion of the detailed test, optionally followed by the Validate Test, confirms the full functionality of CRISPRme, ensuring it is ready to handle large datasets and complex genetic analysis tasks.

3.2.1 Single Chromosome Test


To run the quicker test on chromosome 22 using the 1000 Genomes dataset, execute the following commands:

crisprme.py complete-test \
  --chrom chr22 \
  --vcf_dataset 1000G

After completion, off-target sites generated by this test can be validated using:

crisprme.py validate-test --chrom chr22

3.2.2 Full Genome Test


To run the detailed test across the entire genome using the 1000 Genomes variants, execute the following commands:

crisprme.py complete-test \
  --vcf_dataset 1000G

Once the full genome test has completed, validation can be performed across all chromosomes using:

crisprme.py validate-test

4 Citation

If you use CRISPRme in your research, please cite our paper:

Cancellieri S, Zeng J, Lin LY, Tognon M, Nguyen MA, Lin J, Bombieri N, Maitland SA, Ciuculescu MF, Katta V, Tsai SQ, Armant M, Wolfe SA, Giugno R, Bauer DE, Pinello L. Human genetic diversity alters off-target outcomes of therapeutic gene editing. Nat Genet. 2023 Jan;55(1):34-43. doi: 10.1038/s41588-022-01257-y. Epub 2022 Dec 15. PMID: 36522432; PMCID: PMC10272994.

5 Contacts

6 License

CRISPRme is licensed under the AGPL-3.0 license, which permits its use free of charge for academic and non-profit research and teaching. Under the AGPL, any derivative work that is distributed or offered over a network (SaaS) must itself be released under the AGPL-3.0 with complete corresponding source code.

Commercial licensing

Draft summary — for guidance only. The description below states the intended commercial-licensing model; the binding terms are those of the separate commercial license agreement. Licensing is administered with Mass General Brigham Innovation (which manages the underlying intellectual property). This text is not legal advice and is subject to their review.

Any commercial or for-profit use requires a separate commercial license. The requirement is triggered by the commercial use of CRISPRme itself or of any result, report, or other output it produces — for example in a clinical trial, diagnostic, product, or drug-development program — regardless of who ran the software. In particular, having an academic or non-profit party run CRISPRme on your behalf does not confer commercial rights: the free academic license grants no commercial rights to the outputs.

The model is meant to be fair and to keep CRISPRme widely usable:

  • Academic / non-profit users use CRISPRme freely under the AGPL for their own non-commercial research and teaching — no license, no fee, no time limit.
  • A commercial license covers running CRISPRme and the commercial use of what it produces. Results generated under a valid commercial license may be used and transferred with the associated program — a downstream party (e.g. after an acquisition or out-licensing) does not pay again merely to use a result that was generated under a commercial license. A license is needed to run CRISPRme to produce new results, or to make commercial use of a result that was not generated under a commercial license.
  • Service providers / CROs that run CRISPRme to produce results for third parties require a commercial (service-provider) license.

No warranty. CRISPRme and its outputs are provided "AS IS", without warranty of any kind; predictions are computational, may contain false positives and false negatives, and are not a substitute for experimental validation. Outputs may change as the software, its methods, or the underlying data are updated or improved. To the maximum extent permitted by law, the authors, contributors, and their institutions accept no liability for any use of, or reliance on, CRISPRme or its outputs. (The same disclaimer appears in every generated report.)

For a commercial license or any licensing question, please contact Luca Pinello at lpinello@mgh.harvard.edu.

About

CRISPRme+ — web/data-manager + optimization successor lineage to CRISPRme (machine identity stays 'crisprme', v2.2.0)

Resources

Stars

1 star

Watchers

1 watching

Forks

Releases

Packages

Contributors

Languages