Skip to content

Latest commit

 

History

29 Commits

Folders and files

NameName
Last commit message
Last commit date
 
 
 
 
 
 
 
 

Repository files navigation

LARRY

LARRY (Lineage and RNA recovery) is a tool for labeling cells with a unique lineage barcode that can be read out in single-cell RNA-seq. This repository contains a computational pipeline for transforming raw barcode sequencing data into clonal labels for each cell.

The pipeline has two steps. Step (1) is platform-dependent. The documentation below is specific to the indrops pipeline. 10X users should use this notebook to perform step (1) and then proceed to step (2) as described below.

  1. Sorting and filtering of raw sequencing reads

    • Input: Standard files generated from the indrops pipeline
    • Output: A fastq file with barcode sequences and headers indicating library name, cell barcode and UMI
  2. Clonal annotation of cells

    • Input: The output of step 1 (fastq file with barcodes and headers indicating library nane, cell barcode and UMI)
    • Output: NxM binary matrix, where entry (i,j) is 1 if cell i is in clone j, as well as several plots for evaluating parameter choices are also output.

Step 1: Sorting and filtering of barcode sequencing reads

The purpose of step 1 is to parse the standard output of the indrops pipeline and generate a single file that lists all the valid barcode reads with their associated metadata. The pipeline assumes that the reads were generated from targeted sequencing of the LARRY barcodes, using one of the following (forward) primers for targeting:

TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNcaagtaacgaagagtaaccgttgcta
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGNNNNtaaccgttgctaggagagaccatatg

To perform step (1), copy the LARRY_sorting_and_filtering.py script (from this repository) into the output directory of the indrops pipeline, and then run it from the command line:

python LARRY_sorting_and_filtering.py

The script assumes that the output of the indrops pipeline has the following file structure:

output
├──[Library_name_1]
│   ├──abundant_barcodes.pickle
│   └──filtered_parts
│        └──[Library_name_1]_[Index_1]_.fastq
└──Library_name_N
    ├──abundant_barcodes.pickle
    └──filtered_parts
         └──[Library_name_N]_[Index_N]_.fastq

The script will output a fastq file called LARRY_sorted_and_filtered_barcodes.fastq.gz, which can be carried forward to step (2). Each entry of the fastq file includes a library name, cell barcode, UMI and LARRY barcode sequence, as follows:

>[Library name],[cell barcode],[UMI]
[LARRY barcode sequence]

For example, a typical entry might look like

>Sample1,bcEDSG,CGGATC
ACTATGTACACAGCGGACAATCGAACGAG

Step 2: Clonal annotation of cells

The purpose of step 2 is to aggregate the barcode reads for each cell and perform a series of filtering and quality control steps to produce a final clonal annotation.

The inputs are

  1. A fastq file with the format described above for LARRY_sorted_and_filtered_barcodes.fastq.gz
  2. An ordered list of cell barcodes, corresponding to the rows of the gene expression counts matrix, having the form of a text file with one cell barcode per line
  3. An ordered list of library names, corresponding to the rows of the gene expression counts matrix, having the form of a text file with one library name per line

Note that files (2) and (3) in the above list are output by the [SPRING data_prep pipeline for indrops data] (https://github.com/AllonKleinLab/SPRING_dev/blob/master/data_prep/spring_example_HPCs.ipynb) as cell_bcs_flat.txt and samp_id_flat.txt.

The output is a NxM binary matrix called clone_mat.csv, where entry (i,j) is 1 if cell i is in clone j, as well as several plots for evaluating parameter choices.

The filtering step are:

  1. Collapse the data into unique (Cell,UMI,barcode) triples, keeping track of their respective multiplicities
  2. Merge barcode sequences that are highly similar, i.e. that have a hamming distance less than or equal to H
  3. Filter out (Cell,UMI,BC) triples that are supported by fewer than R reads
  4. Make a final list of (Cell,BC) pairs, keeping those that are supported by at least U UMIs

To run the clonal annotation pipeline, open the clonal_annotation.ipynb jupyter notebook (from this repository) and follow the instructions in the comments. You will need to install the following python packages: numpy, matplotlib, networkx.

About

No description, website, or topics provided.

Resources

Stars

19 stars

Watchers

1 watching

Forks

Releases

Packages

Contributors

Languages